Overblog
Editer l'article Suivre ce blog Administration + Créer mon blog

Le blog de Contra información


Covid 19: Pruebas de fraude mundial. Los tests no prueban el SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado

Publié par Contra información sur 30 Décembre 2020, 12:26pm

Covid 19: Pruebas de fraude mundial. Los tests no prueban el SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado

El COVID-19, y las posteriores respuestas de los gobiernos, parecen formar parte de una conspiración internacional para cometer fraude. No parece haber evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID-19.

A veces tienes que seguir tus instintos. No soy un experto en genética y, como siempre, soy susceptible de ser corregido. Sin embargo, me llamó la atención una investigación publicada en la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados le da una credibilidad adicional a su investigación. Su afirmación es asombrosa.

Los cebadores y las sondas genéticas utilizadas en los ensayos de RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. He seguido las técnicas de investigación descritas en esta traducción inglesa de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos que figuran en los protocolos de la Organización Mundial de la Salud. Tú puedes hacer lo mismo.

D-Salud-Discovery afirma que no hay pruebas que puedan identificar el SARS-CoV-2. Por lo tanto, todas las afirmaciones sobre el supuesto impacto de COVID-19 en la salud de la población son infundadas. El conjunto del relato oficial de COVID-19 es un engaño. Aparentemente, no hay base científica para ninguna parte de este relato.

Si estas afirmaciones son correctas, podemos decir que no hay evidencia de una pandemia, sólo la ilusión de una pandemia. Hemos sufrido pérdidas incalculables sin ninguna razón obvia, salvo las ambiciones de déspotas sin escrúpulos que desean transformar la economía mundial y nuestra sociedad para alcanzar sus objetivos.

Al hacerlo, esta "clase de parásitos" ha cometido potencialmente innumerables crímenes. Estos delitos pueden y deben ser investigados y procesados en un tribunal de justicia.

¿Identificación de qué exactamente?

La Organización Mundial de la Salud (OMS) ha clasificado el COVID-19 (COronaVIrus Disease 2019). Declaró una pandemia global de COVID-19 el 11 de marzo de 2019.

La guía de la OMS sobre los ensayos en laboratorio estipula lo siguiente:

"El agente etiológico [agente causante de la enfermedad] responsable de la totalidad de los casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus (de la misma familia que el SARS-CoV y el MERS-CoV) mediante la secuenciación de la nueva generación (NSG) a partir de virus cultivados, o directamente de muestras recibidas de varios pacientes con neumonía.

La OMS afirma, que el virus del SARS-CoV-2 es la causa de la enfermedad llamada COVID-19. También dicen, que este virus ha sido claramente identificado por los investigadores de Wuhan.

En el informe de la OMS titulado "Nuevo Coronavirus 2019-nCov. Informe de situación 1", declaran:

"Las autoridades chinas han identificado un nuevo tipo de coronavirus, que ha sido aislado el 7 de enero de 2020... El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países la utilizaran en el desarrollo de kits de diagnóstico específicos.

Estas dos declaraciones de la OMS sugieren claramente que se aisló el virus del SARS-CoV-2 (es decir, se purificó para su estudio) y que se identificaron entonces secuencias genéticas a partir de la muestra aislada. A partir de ahí, se desarrollaron y distribuyeron en todo el mundo kits de diagnóstico para testar el virus en ciudades y comunidades de todo el mundo. Según la OMS e investigadores chinos, estos tests ayudarán a encontrar el virus que causa el COVID-19.

Sin embargo, la OMS también afirma:

"Trabajando directamente a partir de las informaciones sobre las secuencias, el equipo ha desarrollado una serie de tests de amplificación genética (PCR) utilizados por los laboratorios.

Los científicos de Wuhan desarrollaron sus tests de amplificación genética basándose en la "información sobre las secuencias" porque no había ninguna muestra aislada, y purificada del famoso virus del SARS-CoV-2. También mostraron imágenes de microscopio electrónico de viriones recientemente descubiertos (la bola de proteína con picos que contienen el ARN viral).

Sin embargo, estas estructuras proteínicas no son únicas. Se asemejan a otras vesículas redondas, como las vesículas endocíticas y los exosomas.

Los virólogos afirman que no es posible "aislar" un virus porque sólo se replica dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque conciernen a las bacterias (que son organismos vivos). En cambio, los virólogos observan los efectos citopatógenos (CPE) del virus, que causan la mutación y la degradación de las células, en los cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez  el genoma completo del SARS-CoV-2, observaron CPEs en las células Vero E6 y Huh7. Los Vero E6 son una línea celular inmortalizada de mono y los Huh7 son células cancerígenas (tumorigénicas) inmortalizadas. Esto significa que se han mantenido in vitro (en cultivos de placas de Petri) durante muchos años.

En el corazón de la historia oficial del SARS-CoV-2 está la idea de que es un virus zoonótico, capaz de pasar de animal al hombre. Cuando los científicos del CDC americano. "infectaron" varias células con el nuevo virus, encontraron lo siguiente:

"Examinamos la capacidad del SARS-CoV-2 para infectar y replicarse en varias líneas celulares comunes de primates y humanos, incluidas las células de adenocarcinoma humano (A549) [células de pulmón], las células de hígado humano (HUH7. 0) y células de riñón embrionarias humanas (HEK-293T), además de las células Vero E6 y Vero CCL81 [células de mono] ... No se observaron efectos citopáticos en ninguna de las líneas celulares excepto en las células Vero [células de mono] ... Las células HUH7. Las células 0 y 293T mostraron sólo una modesta replicación viral y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.

Un elemento central de la historia oficial del SARS-CoV-2 es la idea de que se trata de un virus zoonótico, capaz de cerrar la brecha de especies entre los animales y los humanos. 

El CDC no ha observado ningún CPE en las células humanas. No vieron ninguna evidencia de que este supuesto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco ha mostrado una replicación significativa en las células humanas, lo que sugiere que la infección entre humanos sería imposible.

Viendo este problema, un equipo de científicos polacos introdujo este "virus" secuenciado en las células epiteliales humanas (vías respiratorias). Observaron los efectos en estos cultivos de epitelio humano durante 5 días. Observaron mucha más replicación que los científicos del CDC, pero finalmente dijeron..:

"No observamos ninguna liberación del virus desde el lado basolateral del cultivo del epitelio humano".

Lo que significa que no vieron ninguna prueba de que los supuestos viriones rompieran la membrana de la pared celular. Lo que sugiere que este llamado virus no es infeccioso para los humanos.

No está claro si el SARS-CoV-2 es un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

Viaje de Discovery

El Centro de Control y Prevención de Enfermedades de Wuhan y el Centro Clínico de Salud Pública de Shangai han publicado el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto ha sido actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico del COVID-19 (SARS-CoV-2).

Todas las reclamaciones, tests, tratamientos, estadísticas, desarrollo de vacunas y políticas se basan en esta secuencia. Si los tests de este nuevo virus no identifican nada que pueda causar enfermedades en los humanos, toda la historia de COVID-19 es una mascarada.

Los investigadores de Wuhan declararon de que han reconstruido eficazmente la secuencia del gen del SARS-CoV-2 comparando los fragmentos encontrados en las muestras con otras secuencias genéticas descubiertas anteriormente. A partir del material recolectado, encontraron una correspondencia del 87,1% con el coronavirus del SARS-Cov (SARS-Cov). Utilizaron el ensamblaje de novo y el PCR dirigido y encontraron 29.891 pares de bases que compartían una secuencia que correspondía al 79,6% con el SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento a priori de la secuencia, o del  orden correctos de estos fragmentos. Simplemente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan ha utilizado 40 ciclos de amplificación RT-qPCR para hacer coincidir los fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma publicado del coronavirus del SRAS (SARS-CoV). Desafortunadamente, la precisión del genoma original del coronavirus del SARS tampoco está clara.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo severo (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células de hígado de mono fetal.

Crearon 30 clones a partir del material genético que encontraron. Incapaces de encontrar pruebas de cualquier otro virus conocido, encontraron secuencias genéticas de "origen desconocido" en sólo una de estas muestras clonadas.

Al examinar estas secuencias de ARN desconocidas, encontraron un 57% de correspondencia con el coronavirus bovino y el virus de la hepatitis murina y dedujeron que era de la familia Coronaviridae. Considerando que estas secuencias sugieren un virus del SARS-CoV recientemente descubierto (el nuevo descubrimiento es la ambrosía para los científicos), diseñaron cebadores para  RT-PCR para testar este nuevo virus. Los investigadores declararon..:

"Los cebadores para la detección del nuevo virus fueron diseñados para la detección por RT-PCR del genoma de este coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes de SARS, 22 tenían rastros de ARN de coronavirus humano asociado a la neumonía.

La mitad de los pacientes analizados, todos con síntomas similares, dieron positivo para este nuevo presunto virus. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus del SARS-CoV. La pregunta no se ha planteado.

Este supuesto virus sólo tenía una secuencia cuyo 57% correspondía a un coronavirus supuestamente conocido. El 43% restante estaba justo "ahí". Los datos secuenciales se produjeron y registraron como un nuevo genoma con el número de acceso al GenBank AY274119.

Los investigadores de Wuhan encontraron entonces una coincidencia de secuencia del 79,6% con el AY274119 y por lo tanto lo llamaron una nueva cepa de SARS-CoV (2019-nCoV - eventualmente rebautizado SARS-CoV-2). En ningún momento de este proceso nadie produjo una muestra aislada y purificada de ningún virus. Todo lo que tenían eran porcentajes de concordancia de secuencias con otros porcentajes de concordancia de secuencias.

Aislar nada

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado pero nadie les cree. Esto se debe a que hasta ahora nadie ha proporcionado una sola muestra purificada del virus del SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, eso no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que informaron tener imágenes de los viriones del SARS-CoV-2 que confirmaran que eran efectivamente imágenes de un virus aislado y purificado. Ninguno de ellos fue capaz de hacerlo.

En Australia, los científicos del Instituto Doherty anunciaron que habían aislado el virus del SARS-CoV-2. Cuando se les pidió que lo explicaran, los científicos dijeron: "Tenemos cortas secuencias (ARN) provenientes del test de diagnóstico que pueden ser utilizadas en los tests de diagnóstico.

Esto explica por qué el gobierno australiano declara:

"La fiabilidad de los tests de COVID-19 es incierta debido a las escasas pruebas disponibles... Hay pocas pruebas para evaluar la precisión y la utilidad clínica de los tests de COVID-19 disponibles”.

En el Reino Unido, en julio, un grupo de académicos preocupados escribió una carta al Primer Ministro británico Boris Johnson en la que le pedían que:

"Producir pruebas científicas independientes, examinadas por pares, de que el virus COVID-19 ha sido aislado.

Hasta la fecha, no han recibido respuesta.

Del mismo modo, el investigador británico Andrew Johnson ha presentado una solicitud en relación a la  libertad de información a Public Health England (PHE).. Les pidió que le proporcionaran sus registros que describían el aislamiento de un virus de SARS-VOC-2. A lo que respondieron:

"PHE puede confirmar que no tienen informaciones de la manera sugerida por vuestra petición".

La investigadora canadiense Christine Massey hizo una solicitud similar de acceso a la información, pidiendo al gobierno canadiense la misma información. El gobierno canadiense respondió:

"Después de realizar una investigación exhaustiva, lamentamos informarle que no hemos podido encontrar ningún documento que responda a su solicitud".

En los Estados Unidos, el panel de diagnóstico de RT-PCR del del Centro para el Control de Enfermedades (CDC) afirma:

"... No existe actualmente ningún aislado de virus cuantificado de 2019-nCoV... La detección de ARN viral puede no indicar la presencia de un virus infeccioso o que  2019-nCoV es el agente responsable de los síntomas clínicos.

Actualizado por última vez el 13 de julio de 2020, el CDC aún no ha obtenido una muestra viral pura de un paciente que dice tener la enfermedad del COVID-19. Admiten abiertamente que sus tests no muestran necesariamente si el SARS-CoV-2 está presente, o causa el COVID-19.

Se nos dice que nada de esto importa. Que somos ignorantes y simplemente no entendemos la virología. Por lo tanto, tenemos que aceptar imágenes de cosas que sabemos que podrían ser otra cosa, y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

Tests para nada

La OMS, así como todos los gobiernos, grupos de reflexión, comités directivos, asesores científicos gubernamentales, instituciones supranacionales y otras entidades que promueven la presentación oficial de COVID-19, afirman que el SARS-CoV-2 es la causa de COVID-19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicado el supuesto genoma del SARS-CoV-2. Es de dominio público.

Secuencias genéticas claves en el genoma del SARS-CoV-2 tendrían funciones específicas. Estas son las proteínas objetivo que los científicos están probando para identificar la presencia del "virus". Se trata de:

  • El Gen de la ARN polimerasa (Rd-Rp): permite que el ARN del SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas de COVID 19.
  • El Gen S (Orf2): esta glicoproteína forma el pico en la superficie del virión del SARS-CoV-2 que supuestamente facilita la unión del SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN del interior de la envoltura de la proteína del virión (cápside) pase a la  célula ahora  infectada .
  • EL Gen E (Orf1ab): una pequeña proteína de membrana utilizada en el ensamblaje viral
  • Gen N (Orf9a): el gen de la nucleocápside que se une al ARN cuando se forma la cápside.

La OMS lleva un registro a disposición del público de los cebadores y las sondas RT-PCR utilizadas para testar la presencia del SARS-CoV-2. Los cebadores son secuencias de nucleótidos específicos que se unen (se anulan entre sí) a las cadenas antisentido y sensorial del ADNc sintetizado (llamados cebadores directos e inversos, respectivamente).

Las hebras de ADNc se separan cuando se calientan y se vuelven a formar cuando se enfrían. Antes del enfriamiento, se introducen secuencias de nucleótidos llamadas sondas para hibridar a regiones específicas del presunto genoma viral. Durante la amplificación, a medida que las regiones entre los cebadores se alargan, cuando un cebador golpea una sonda, ésta se desintegra, liberando un fluorescente o un colorante que puede ser leído por los investigadores.

Es la identificación de estos marcadores lo que los científicos pretenden probar la presencia del SARS-CoV-2 en una muestra.

Otra herramienta accesible al público es Basic Local Alignment Search Tool (BLAST). Permite a cualquiera comparar las secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genéticos de la National Institutes of Health (NIH) americana  llamada GenBank. Por lo tanto, podemos hacer explotar los cebadores, sondas y secuencias de genes objetivo reclamados para el SARS-CoV-2.

Los protocolos de la OMS relacionados con los cebadores y las sondas directos e inversos para el genoma viral del presunto SARS-CoV-2 se basan en perfiles de los genes RoRp, Orf1, N y E. Cualquiera puede pasarlos en BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, usada como cebador directo, es - ATGAGCTTAGTCCTGTG. Si pasamos un nucleótido en BLAST, se registra como un aislado completo de SARS-CoV-2 con una identidad de secuencia del 100%. De manera similar, la secuencia del cebador del gen E - ATATTGCAGCAGTACGCACACA - revela la presencia de la secuencia Orf1ab que también identifica el SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar secuencias de nucleótidos en los genomas microbianos y humanos. Si buscamos la secuencia RoRp del SARS-CoV-2, revela 99 cromosomas humanos con una identidad de secuencia del 100%. Orf1ab (gen E) devuelve el 90 con una coincidencia de identidad de secuencia  del 100% con los cromosomas humanos.

Al hacer lo mismo para estas secuencias con una búsqueda microbiana, se encuentran 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios coincidentes, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los marcadores genéticos únicos del SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o de alto porcentaje con diversos fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos, como el Proyecto Health Feedback de Reuters, se han apresurado a desestimar las reclamaciones de quienes han observado la aparente falta de especificidad del supuesto genoma del SARS-CoV-2.

Utilizando una serie de argumentos de hombre de paja como "esta afirmación sugiere que cada test debería ser positiva" (lo cual no es así), su intento de  desacreditación se ejecuta de esta manera:  

"Los cebadores están concebidos para unirse a secuencias de nucleótidos específicas que son exclusivas virus. El cebador directo puede unirse a un cromosoma en particular, pero el cebador trasero no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus del SARS-CoV-2. Además, debido a que los cebadores directos y reversos envuelven la secuencia al ser amplificada, la secuencia cDMA entre los cebadores es única para el virus.

Esto parece distorsionar deliberadamente el significado de estos resultados presentando un argumento que nadie más que los propios verificadores de hechos están haciendo. Las investigaciones realizadas por BLAST muestran que estas secuencias  objetivos no son exclusivas del SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron  la epidemiología de los presuntos casos marroquíes de SARS-CoV-2. El 9% de los casos fueron positivos para tres genes, el 18% para dos genes y el 73% para uno. Como se mencionó anteriormente, muchos de ellos pueden no haber sido positivos para ninguno de los genes.

Esto es totalmente acorde con las directrices de la OMS en materia de tests. Afirman:

"Un diagnóstico óptimo consiste en un test de amplificación del ácido nucleico (NAAT) con al menos dos objetivos independientes en el genoma del SARS-CoV-2; sin embargo, en las zonas donde la transmisión está extendida, se puede utilizar un simple algoritmo de un solo objetivo (...). Uno o más resultados negativos no descartan necesariamente la infección por el SARS-CoV-2".

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados ,  si los cebadores directo e inverso identifican basura, tal vez uno sea el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos probablemente también sea basura.

El argumento de que la RT-PCR sólo encuentra ARN es engañoso. La transcripción natural (la separación de las cadenas de ADN) se produce durante la expresión de los genes. Nadie está diciendo que cromosomas o microbios enteros estén secuenciados en el llamado genoma SARS-CoV-2. Sin embargo, hasta donde sabemos. Dicen que los llamados marcadores, usados para testar este supuesto virus, no son adecuados para el propósito.

Los tests de RT-PCR no secuencian el genoma entero. Buscan incidentes de floración de sondas específicas para indicar la presencia de las llamadas secuencias existentes. Estas secuencias están definidas por el LV908947.1 y sus posteriores actualizaciones. Estos cebadores y sondas sólo pueden revelar coincidencias de ARN extraído de ADN no codificante, a veces denominado "basura" (ADNc).

Por ejemplo, se cree que el gen S del SARS-CoV-2  es muy específico del genoma del SARS-CoV-2. La secuencia del objetivo es - TTGGCAAAAATTCAAGACTTTTC. Una investigación microbiana BLAST produjo 97 coincidencias microbianas con un 100% de coincidencia de secuencia de identidad. El porcentaje de coincidencia más bajo, entre los primeros 100, es del 95%. La investigación del genoma humano también encontró una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde se mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de test de la OMS que identifique claramente lo que es. El conjunto del genoma podría estar equivocado. Los tests no prueban el SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si ese es el caso, debido a que no hay aislamientos o muestras purificadas del virus, sin una prueba viable, no hay pruebas de SARS-CoV-2. Por lo tanto, tampoco hay pruebas de la existencia de una enfermedad llamada COVID-19.

Esto isignifica que no existe una base científica para ninguna afirmación sobre el número de casos de COVID 19, las admisiones hospitalarias o las cifras de mortalidad. Es muy posible que todas las medidas tomadas para  combatir  este  virus mortal no  se basen en nada.

Fraude concluyente

El fraude es un acto criminal. La definición jurídica de fraude es la siguiente:

"Una práctica engañosa o un plan deliberado, utilizado con la intención de privar a otra persona de su derecho, o de causar daño a esa persona de cualquier manera.

La definición jurídica de una conspiración es la siguiente:

"Una combinación o confederación entre dos o más personas formada con el propósito de cometer, a través de sus esfuerzos conjuntos, un acto ilegal o criminal.

Parece que los que afirman que nos enfrentamos a una pandemia no han aportado pruebas de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID-19. Todas las informaciones que sugieren firmemente esta posibilidad son de dominio público. Cualquiera puede leerlas.

Para que haya fraude, el engaño debe ser deliberado. La intención debe ser privar deliberadamente a los demás de sus derechos o perjudicarlos de alguna manera. Si hay pruebas de colusión entre individuos y/u organizaciones para cometer fraude, entonces se trata de una conspiración (en las jurisdicciones de derecho consuetudinario) o de una Empresa Criminal Conjunta (JCE) según el derecho internacional.

Parece que COVID-19 fue usado deliberadamente como casus belli para hacer la guerra a la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de movimiento ha sido restringida, la libertad de expresión ha sido erosionada, el derecho a la protesta ha sido restringido, hemos sido separados de nuestros seres queridos, nuestros negocios han sido destruidos, hemos sido bombardeados psicológicamente, amordazados y aterrorizados.

Peor aún, si bien no hay pruebas de una mortalidad sin precedentes por todas las causas, se han producido picos en la mortalidad fuera de temporada. Estas cifras corresponden precisamente a las medidas de "confinamiento" que han visto la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una presunta enfermedad con exclusión de todas las demás.

Además, los que han transmitido la historia de COVID-19 proponen que esta supuesta enfermedad justifica la completa reestructuración de la economía mundial, nuestros sistemas políticos, nuestras sociedades, nuestras culturas y la propia humanidad.

Para poder participar en su llamada "nueva normalidad", que es la transformación completa de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, entre otros, la vigilancia biométrica de cada uno, el control y la supervisión centralizados de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y la exigencia efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esta es la condición de la esclavitud.

No hay duda de que hemos sido privados de derechos y heridos. En los tribunales ordinarios se presume la inocencia, pero las pruebas de que el daño fue causado deliberadamente por una conspiración internacional son abrumadoras. Las políticas destructivas adoptadas por los gobiernos de todo el mundo se originaron claramente en los grupos de reflexión globalistas y en las instituciones supranacionales mucho antes de la aparición de esta inexistente pandemia.

En las jurisdicciones del Código Napoleón, la culpabilidad se presume. Para que los conspiradores acusados demuestren su inocencia, deben demostrar que, a pesar de sus inconmensurables recursos, fueron colectivamente incapaces de acceder o entender las pruebas libremente disponibles que sugieren que elCOVID-19 es un mito.

Los responsables del crimen de conspiración para cometer fraude mundial deben ser llevados ante la justicia. Si son condenados, deberían ser encarcelados mientras el resto de nosotros trabajamos para reparar el daño que ya han causado.

 

Fuente: off-guardian.org

Pour être informé des derniers articles, inscrivez vous :
Commenter cet article

Archives

Nous sommes sociaux !

Articles récents